Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

tRNA Record for Treponema pallidum


MiniMap tRNA-Ala-1 rRNA-5SrRNA_2 rRNA-16SrRNA_2 rRNA-23SrRNA_2 IGR212 IGR210 IGR209 IGR211 braC, - TP0265 TP0266 TP0267 TP0268 deoC, - TP0264 TP0269 braC, - TP0265 TP0266 TP0267 TP0268 deoC, - TP0264 TP0269 braC, - TP0265 TP0266 TP0268 deoC, - TP0264 TP0269 TP0267

tRNA ID: tRNA-Ala-3

tRNA Start:
1082583

tRNA Stop:
1082510

IGS ID:
IGR211

Anticodon:
GGC

tRNA Nucleotide Sequence:
GGGGATGTAGCTCAGTTGGTTAGAGCGCTTGCATGGCATGCAAGAGGTCA
GGGGTTCGATTCCCCTCATCTCCA

Comment:



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy