Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

tRNA Record for Neisseria gonorrhoeae


MiniMap tRNA-Ala-2 tRNA-Ile-1 rRNA-5S-2 rRNA-16S-2 rRNA-23S-2 IGR1065 IGR1064 IGR1061 IGR1062 IGR1062.1 IGR1063 NG1306 comE, - NG1305 spoT, - NG1308 NG1303 tpn, - NG1302 NG1301 dfp, - NG1307 NG1306 comE, - NG1305 spoT, - NG1308 NG1303 tpn, - NG1302 NG1301 dfp, - NG1307 Type: direct, Name:  - 108 Type: direct, Name:  - 105 Type: direct, Name:  - 101 Type: direct, Name:  - 123 Type: direct, Name:  - 113 Type: direct, Name:  - 104 Type: direct, Name:  - 109 Type: direct, Name:  - 121 NG1306 comE, - NG1305 spoT, - NG1308 NG1303 NG1301 dfp, - NG1307 tpn, - NG1302

tRNA ID: tRNA-Ala-2

tRNA Start:
1261670

tRNA Stop:
1261595

IGS ID:
IGR1063

Anticodon:
TGC

tRNA Nucleotide Sequence:
GGGGGCATAGCTCAGTTGGTAGAGCACCTGCTTTGCAAGCAGGGGGTCAT
CGGTTCGATCCCGTTTGCCTCCACCA

Comment:



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy