Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

tRNA Record for Mycoplasma genitalium


MiniMap tRNA-Asp-1 tRNA-Phe-1 tRNA-Pro-1 tRNA-Met-3 tRNA-Met-2 tRNA-Met-1 tRNA-Cys-1 tRNA-Ser-2 IGR156 IGR158 IGR155 IGR157 pfk, - MG215 MG217 MG213 pyk, - MG216 hmw2, - MG218 pfk, - MG215 MG217 MG213 pyk, - MG216 hmw2, - MG218 Type: tandem, Name:  - 5 Type: tandem, Name:  - 6 Type: direct, Name:  - 24 Type: inverted, Name:  - 56 Type: direct, Name:  - 24 Type: inverted, Name:  - 56 pfk, - MG215 MG217 MG213 pyk, - MG216 hmw2, - MG218 MG214 plsC, - MG212 MG214 plsC, - MG212

tRNA ID: tRNA-Asp-1

tRNA Start:
257741

tRNA Stop:
257814

IGS ID:
IGR157

Anticodon:
GTC

tRNA Nucleotide Sequence:
GGTTCCATGGTGTAGTGATAACATATCTCCCTGTCACGGAGGGGTTGCGG
GTTTGATTCCCGTTGGAACCGCCA

Comment:



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy