Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

tRNA Record for Haemophilus ducreyi


MiniMap tRNA-Pro-1 tRNA-Arg-2 IGR809 IGR807 IGR802 IGR801 IGR808 IGR804 IGR806 IGR803 IGR805 yfiA, - HD1105 fdoI,fdxI, - HD1111 kdkA, - HD1101 fdhE, - HD1110 folE, - HD1103 fdhD, - HD1113 truA,hisT, - HD1104 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 HD1109 yfiA, - HD1105 fdoI,fdxI, - HD1111 kdkA, - HD1101 fdhE, - HD1110 folE, - HD1103 fdhD, - HD1113 truA,hisT, - HD1104 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 HD1109 yfiA, - HD1105 fdoI,fdxI, - HD1111 kdkA, - HD1101 fdhE, - HD1110 fdxH, - HD1112 HD1102 fdxH, - HD1112 HD1102 folE, - HD1103 fdhD, - HD1113 truA,hisT, - HD1104 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 HD1109

tRNA ID: tRNA-Arg-2

tRNA Start:
883103

tRNA Stop:
883027

IGS ID:
IGR805

Anticodon:
TCT

tRNA Nucleotide Sequence:
GCGCCCTTAGCTCAGCTGGATAGAGCAACGCCCTTCTAAGGCGTGGGTCA
AAGGTTCGAATCCTTTAGGGCGTGCCA

Comment:



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy