Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

tRNA Record for Chlamydia pneumoniae



tRNA ID: tRNA_Arg_3

tRNA Start:
807413

tRNA Stop:
807341

IGS ID:


Anticodon:
TCT

tRNA Nucleotide Sequence:
GGACCGATAGCTCAGTGGATAGAGCATTCGCCTTCTAAGCGAATGGTCGC
AGGTTCGAGTCCTGCTCGGTCCG

Comment:



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy