Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

tRNA Record for Chlamydia trachomatis


MiniMap tRNA-Val-2 tRNA-Ser-4 IGR699 IGR692 IGR700 IGR697 IGR695 IGR696 IGR701 IGR691 IGR693 IGR698 IGR694 CT832 murB, - CT831 CT839 CT838 rl35, - CT834 rl20, - CT835 yggH, - CT829 infC, - CT833 ytgB, - CT830 CT840 pheS, - CT836 CT837 CT832 murB, - CT831 CT839 CT838 rl35, - CT834 rl20, - CT835 yggH, - CT829 infC, - CT833 ytgB, - CT830 CT840 pheS, - CT836 CT837 CT832 murB, - CT831 CT839 CT838 rl20, - CT835 infC, - CT833 ytgB, - CT830 CT840 pheS, - CT836 CT837 rl35, - CT834 yggH, - CT829

tRNA ID: tRNA-Ser-4

tRNA Start:
984330

tRNA Stop:
984414

IGS ID:
IGR698

Anticodon:
TGA

tRNA Nucleotide Sequence:
GGAAGAATGGCAGAGCGGTTTAATGCACCTGTCTTGAAAACAGGAGACCT
GAAAGGGTCCGGGGGTTCGAATCCCTCTTCTTCCG

Comment:



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy