Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

tRNA Record for Chlamydia trachomatis


MiniMap tRNA-Ser-1 IGR302 IGR295 IGR298 IGR299 IGR301 IGR300 IGR294 IGR296 IGR297 CT357R def, - CT353 bioY, - CT359 CT360 kgsA, - CT354 dapA, - CT361 CT355 lysC, - CT362 CT356 CT357 CT358 CT357R def, - CT353 bioY, - CT359 CT360 kgsA, - CT354 dapA, - CT361 CT355 lysC, - CT362 CT356 CT357 CT358 CT357R def, - CT353 bioY, - CT359 CT360 kgsA, - CT354 dapA, - CT361 CT355 lysC, - CT362 CT356 CT358 CT357

tRNA ID: tRNA-Ser-1

tRNA Start:
409238

tRNA Stop:
409324

IGS ID:
IGR297

Anticodon:
CGA

tRNA Nucleotide Sequence:
GGAAGAGTGGCAGAGTGGTCGAATGCATCTGATTCGAAATCAGAAGTCCC
TCAACGGGGACCGGGGGTTCAAATCCCTTCTCTTCCG

Comment:



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy