Chlamydia pneumoniae Repeat Records Search


  Sequence Database         


Record 1 of 1
MiniMap tRNA_Ser_2 IGR483 IGR482 IGR481 IGR484 IGR485 IGR486 pgsA, - CPn0615 pyr5, - CPn0608 sohB, - CPn0613 rho, - CPn0610 adt, - CPn0614 polA, - CPn0612 CPn0609 dnaB, - CPn0616 pgsA, - CPn0615 pyr5, - CPn0608 sohB, - CPn0613 rho, - CPn0610 adt, - CPn0614 polA, - CPn0612 CPn0609 dnaB, - CPn0616 Type: tandem, Name:  - 9 pgsA, - CPn0615 pyr5, - CPn0608 sohB, - CPn0613 rho, - CPn0610 adt, - CPn0614 polA, - CPn0612 CPn0611 CPn0611 CPn0609 dnaB, - CPn0616

Repeat ID: 9

DNA Molecule Name:
1

Repeat Name:


Repeat Type:
tandem

Copy Number:
2.00

Comment:


Consensus:
CAAGCTACAACAGATCTTTA

Repeat Unit Coordinates:
StartStop
704189704210
704211704230


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy