Chlamydia pneumoniae Repeat Records Search


  Sequence Database         


Record 1 of 1
MiniMap IGR350 IGR351 IGR352 IGR354 IGR353 CPn0442 CPn0441 CPn0443 pmpG, - CPn0445 pmpG, - CPn0444 CPn0442 CPn0441 CPn0443 pmpG, - CPn0445 pmpG, - CPn0444 Type: tandem, Name:  - 7 CPn0442 CPn0441 CPn0443 pmpG, - CPn0445 pmpG, - CPn0444

Repeat ID: 7

DNA Molecule Name:
1

Repeat Name:


Repeat Type:
tandem

Copy Number:
2.20

Comment:


Consensus:
GGAGCGATCTATACAGAAACTGAAGATTTTACTCTTACAGGAAGTACGGG
AACCGTGACCTTCAGCACAAATACAGCAAAGACAGGCGGCGCCTTATATT
CTAAAGGAAACAACTCGCTGACTGGAAATACCAACCTGCTCTTTTCAGGG
AACAAAGCTACGGGCCCGAGTAATTCTTCAGCAAATCAAGAGGGTTGCGG
TGGGGCAATCCTAGCCTTTATTGAGTCAGCATCCGTAAGCGATAAAAAAG
GACTATCGATTGCAAACAACCAAGAAGTCAGCCTCACTAGTAATACTGCA
ACAGTAAGTGGCGGTGCGATCTATGCGACCAAATGTACTCTAACTGGAAA
CACGACTCTGACCTTTGACGGCAATACTGCCGAAACTGCAGGA

Repeat Unit Coordinates:
StartStop
491358491750
491751492143
492144492228


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy