Chlamydia pneumoniae Repeat Records Search


  Sequence Database         


Record 1 of 1
MiniMap tRNA_Met_2 tRNA_Met_3 IGR135 IGR133 IGR130 IGR138 IGR132 IGR136 IGR131 IGR137 IGR129 IGR134 CPn0155 CPn0159 CPn0156 CPn0157 CPn0158 CPn0161 CPn0162 pfpA, - CPn0160 CPn0163 CPn0165 leuS, - CPn0153 CPn0155 CPn0159 CPn0156 CPn0157 CPn0158 CPn0161 CPn0162 pfpA, - CPn0160 CPn0163 CPn0165 leuS, - CPn0153 Type: tandem, Name:  - 2 CPn0156 CPn0158 CPn0161 CPn0162 pfpA, - CPn0160 CPn0155 CPn0159 CPn0157 leuS, - CPn0153 CPn0164 kdtA,gseA, - CPn0154 kdtA,gseA, - CPn0154 CPn0165 CPn0163 CPn0164

Repeat ID: 2

DNA Molecule Name:
1

Repeat Name:


Repeat Type:
tandem

Copy Number:
2.00

Comment:


Consensus:
AGGCGAATGCGTTTGATTTTCCCAAAGCAGGGTCAAAGGTCGTTGATCTA
TAAGCTCCTCTTTCCCGAAGTACTGTAAAGGGCCTGGAA

Repeat Unit Coordinates:
StartStop
202077202165
202166202254


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy