Chlamydia pneumoniae Repeat Records Search


  Sequence Database         


Record 1 of 1
MiniMap IGR7 IGR4 IGR3 IGR5 IGR6 CPn0006 CPn0008 CPn0009 gatB, - CPn0004 pmpG, - CPn0005 CPn0007 CPn0006 CPn0008 CPn0009 gatB, - CPn0004 pmpG, - CPn0005 CPn0007 Type: tandem, Name:  - 1 Type: direct, Name:  - 14 Type: direct, Name:  - 14 Type: direct, Name:  - 16 Type: direct, Name:  - 16 CPn0006 CPn0008 CPn0009 gatB, - CPn0004 pmpG, - CPn0005 CPn0007

Repeat ID: 16

DNA Molecule Name:
1

Repeat Name:


Repeat Type:
direct

Copy Number:
2.00

Comment:
length:243, Evalue:2.13e-135

Consensus:
GTGGTGTGGTATTGCTTACTGTAGCGATCCCTGGATTAAGTTCAGTCATT
TCTTCCCCGGCAGGGATGGGTGCCTGTGCTTTGGGATGTGTGATGCTTGC
TTTAGGGATCGATGTTCTTCTGAAGAAACGAGAAGTCCCTATAGTTCTCG
CATCTGTAACTACGACACCAGGAACTGGCAGCCCTAGAAGTGGTATTTCT
ATTTCAGGAGCTGATAGCACCATACGTTCTCTTCCTACGTATC

Repeat Unit Coordinates:
StartStop
76667908
79968238


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy