Chlamydia pneumoniae Repeat Records Search


  Sequence Database         


Record 1 of 1
MiniMap IGR771 IGR776 IGR778 IGR775 IGR773 IGR777 IGR774 IGR772 IGR770 ftsY, - CPn0972 pcnB_2, - CPn0966 CPn0969.1 yccA_2, - CPn0971 sucD, - CPn0974 sucC, - CPn0973 tyrP_1, - CPn0969 tyrP_2, - CPn0970 mrsA, - CPn0967 glmS, - CPn0968 ftsY, - CPn0972 pcnB_2, - CPn0966 CPn0969.1 yccA_2, - CPn0971 sucD, - CPn0974 sucC, - CPn0973 tyrP_1, - CPn0969 tyrP_2, - CPn0970 mrsA, - CPn0967 glmS, - CPn0968 Type: direct, Name:  - 15 Type: direct, Name:  - 21 Type: direct, Name:  - 15 Type: direct, Name:  - 20 Type: direct, Name:  - 12 Type: direct, Name:  - 20 Type: direct, Name:  - 17 Type: direct, Name:  - 12 Type: direct, Name:  - 21 Type: direct, Name:  - 17 ftsY, - CPn0972 pcnB_2, - CPn0966 CPn0969.1 yccA_2, - CPn0971 sucD, - CPn0974 sucC, - CPn0973 tyrP_1, - CPn0969 tyrP_2, - CPn0970 mrsA, - CPn0967 glmS, - CPn0968

Repeat ID: 15

DNA Molecule Name:
1

Repeat Name:


Repeat Type:
direct

Copy Number:
2.00

Comment:
length:149, Evalue:8.36e-79

Consensus:
GTCTCCTCTTTTGTAGGAGTTGCTCTCGGTGTTATGGACTTCCTGGCAGA
CGGTTTAAAATGGAATAAAAAATCACATCCATTTTCAATTTTCTTTTTAA
CATTTATTATTCCCCTTGCTTGGGCTGTTTGTTATCCTGAAATTGTTTT

Repeat Unit Coordinates:
StartStop
11126581112806
11143071114455


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy