Chlamydia pneumoniae Repeat Records Search


  Sequence Database         


Record 1 of 1
MiniMap IGR11 IGR9 IGR7 IGR10 IGR8 IGR12 IGR6 CPn0008 CPn0011 CPn0010 CPn0009 CPn0010.1 CPn0012 pmpG, - CPn0013 CPn0007 CPn0008 CPn0011 CPn0010 CPn0009 CPn0010.1 CPn0012 pmpG, - CPn0013 CPn0007 Type: direct, Name:  - 13 Type: direct, Name:  - 18 Type: direct, Name:  - 19 CPn0008 CPn0011 CPn0010 CPn0009 CPn0010.1 CPn0012 pmpG, - CPn0013 CPn0007

Repeat ID: 13

DNA Molecule Name:
1

Repeat Name:


Repeat Type:
direct

Copy Number:
2.00

Comment:
length:926, Evalue:0.00e+00

Consensus:
CCCCCCCCCCCCCAACACTCTGTAGGGTCGATTTCTTCTCCATCTAAACT
TCGCGTTTTAGCGATTACTTTTTTAGTTTTTGGTATGCTCTTACTGATTT
CAGGAGCTCTCTTTCTGACGTTAGGGATTCCAGGATTGAGTGCAGCAATT
TCTTTTGGATTAGGCATCGGTCTCTCCGCATTAGGAGGAGTGCTGATGAT
TTCGGGACTACTATGTCTTTTAGTAAAACGAGAGATTCCGACAGTACGAC
CAGAAGAAATTCCTGAAGGGGTTTCGCTGGCTCCTTCTGAGGAGCCAGCT
CTACAGGCAGCTCAGAAGACTTTAGCTCAGCTGCCTAAGGAATTGGATCA
GTTAGATACAGATATTCAGGAAGTGTTCGCATGTTTAAGAAAGCTGAAAG
ATTCTAAGTATGAAAGTCGAAGTTTTTTAAACGATGCTAAGAAGGAGCTT
CGAGTTTTTGACTTTGTGGTTGAGGATACCCTCTCGGAGATTTTCGAGTT
GCGGCAGATTGTGGCTCAAGAGGGATGGGATTTAAACTTTTTGATCAATG
GGGGACGAAGCCTCATGATGACTGCAGAATCTGAATCGCTTGATTTGTTT
CATGTATCGAAGCGGCTAGGGTATTTACCTTCTGGGGATGTTCGAGGGGA
GGGGTTAAAGAAATCTGCGAAGGAGATAGTCGCTCGTTTGATGAGCTTGC
ATTGCGAGATTCACAAGGTGGCGGTAGCGTTTGATAGGAATTCCTATGCG
ATGGCAGAAAAGGCGTTTGCGAAAGCGTTGGGAGCTTTAGAAGAGAGTGT
GTATCGGAGTCTGACGCAGAGTTATAGAGATAAATTTTTGGAGAGCGAGA
GGGCGAAGATCCCATGGAATGGGCATATAACCTGGTTAAGAGATGATGCG
AAGAGTGGGTGTGCTGAAAAGAAGCT

Repeat Unit Coordinates:
StartStop
1335114276
12070611207986


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy