Chlamydia pneumoniae Repeat Records Search


  Sequence Database         


Record 1 of 1
MiniMap IGR541 IGR537 IGR540 IGR542 IGR535 IGR536 IGR538 IGR539 CPn0678 CPn0681 fmu, - CPn0674 CPn0677 CPn0675 CPn0676 pgk, - CPn0679 ygo4, - CPn0680 dppD, - CPn0682 CPn0678 CPn0681 fmu, - CPn0674 CPn0677 CPn0675 CPn0676 pgk, - CPn0679 ygo4, - CPn0680 dppD, - CPn0682 Type: tandem, Name:  - 10 CPn0678 CPn0681 fmu, - CPn0674 CPn0677 CPn0675 CPn0676 pgk, - CPn0679 ygo4, - CPn0680 dppD, - CPn0682

Repeat ID: 10

DNA Molecule Name:
1

Repeat Name:


Repeat Type:
tandem

Copy Number:
2.20

Comment:


Consensus:
TTAGGAGGTGGGGTGCTGGACCCTTCCCATGCGTTGCCGCGCGCTTAGCA
TTAGTCCCACCCGTT

Repeat Unit Coordinates:
StartStop
760752760817
760818760883
760884760896


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy