Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results

Record: 1 of 1  
MiniMap IGR1196 IGR1190 IGR1191 IGR1193 IGR1189 IGR1187 IGR1194 IGR1195 IGR1192 IGR1188 NG1465 NG1461 opaG,PII, - NG1464 NG1455 lysS, - NG1454 purH, - NG1466 NG1460 NG1459 NG1457 NG1462 NG1458 pepP, - NG1456 NG1465 NG1461 opaG,PII, - NG1464 NG1455 lysS, - NG1454 purH, - NG1466 NG1460 NG1459 NG1457 NG1462 NG1458 pepP, - NG1456 Type: inverse, Name:  - 157 Type: tandem, Name:  - 65 Type: tandem, Name:  - 66 Type: tandem, Name:  - 67 NG1465 NG1461 opaG,PII, - NG1464 NG1455 lysS, - NG1454 purH, - NG1466 NG1462 NG1458 pepP, - NG1456 NG1459 NG1457 NG1460

Repeat ID: 65

DNA Molecule Name:
1

Repeat Name:


Repeat Type:
tandem

Copy Number:
3.40

Comment:


Consensus:
AGGTTGTGCAGGCTGTTTTTTGCTTTTCAGACGACCTGAAATCAACGGTT
GTAAATCCAATCTGTTTTTCAAACCGCCTGCAACCGCCAAATCTGCCGCA
ACCTGCCCCCTCCCCCGTGGGGGAGGGCCGGGGAGAGGGCATTCTCCAAG
TTGCGGCAACCTTTCCCAACAACTTAACCGCCCCAATACAAGCCTTGCGG
CTTGTTGCCCTCTCTCCAGCCCTCTCCCACGGGGAGAGAGGACGGGGAGG
CTGTTGGGGTTAAGGGTTTTGTAAACTAATC

Repeat Unit Coordinates:
StartStop
14254351425714
14257151425993
14259941426272
14262731426397


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy