Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results

Record: 1 of 1  
MiniMap IGR0970 IGR0971 IGR0968 IGR0970.1 IGR0969 IGR0972 IGR0973 NG1201 trpG, - NG1204 pivNG, - NG1200 trpD, - NG1203 NG1202 tonB, - NG1205 hrpA, - NG1199 NG1201 trpG, - NG1204 pivNG, - NG1200 trpD, - NG1203 NG1202 tonB, - NG1205 hrpA, - NG1199 Type: inverse, Name:  - 167 Type: inverse, Name:  - 143 Type: inverse, Name:  - 144 Type: inverse, Name:  - 162 Type: inverse, Name:  - 182 NG1201 trpG, - NG1204 pivNG, - NG1200 trpD, - NG1203 NG1202 tonB, - NG1205 hrpA, - NG1199

Repeat ID: 162

DNA Molecule Name:
1

Repeat Name:


Repeat Type:
inverse

Copy Number:
2.00

Comment:
length:478, Evalue:2.14e-276

Consensus:
CAAAAAACCCGTTACCTCCGAGACCGCCGCGGCCGTCCCGCCCATCCCCT
GTCGTCCATGTTCAAAGCCGTCCTGCCCGGACAATGGCACAGCCTCTCCG
ATCCCGAACTCGAACACAGCCTCATCACCCGCATCGGTTTCAACCTGTTT
TGCCGTTTTGACGGACCGGGCATCCCCGGTTGCAGCACCTTATGCCGCTA
CCGTAAATTCCGCTATGCGCGGGCAGCCTATTTCGGGCTGCTCAAAGTGG
GTGCGCAAAGCCACCTGAAGGCGATGTGTTTGAACCTGTTGAAAGCCGCC
AACAGGCTAAGTGCGCCCGCTGCCGCCTAAAAGGCGGCCCGGATGCCTGA
TTATCGGGTATCCGGGGAGGATTAAGGGGATATTCGGGTAAAATTAGGAG
GTATTTGGGGCGAAAACAGCTGAAAACCTGTGTTTGGGTTTCGGATGTCG
AAGGAAGGGCTTTTTTGCAAAGGCCTCA

Repeat Unit Coordinates:
StartStop
11487871149265
15411291541607


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy