Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Mycoplasma genitalium Search Results

Record: 1 of 1  
MiniMap tRNA-Asp-1 tRNA-Phe-1 tRNA-Pro-1 tRNA-Met-3 tRNA-Met-2 tRNA-Met-1 tRNA-Cys-1 tRNA-Ser-2 IGR156 IGR158 IGR155 IGR157 pfk, - MG215 MG217 MG213 pyk, - MG216 hmw2, - MG218 pfk, - MG215 MG217 MG213 pyk, - MG216 hmw2, - MG218 Type: tandem, Name:  - 5 Type: tandem, Name:  - 6 Type: tandem, Name:  - 7 Type: direct, Name:  - 24 Type: inverted, Name:  - 56 Type: direct, Name:  - 24 Type: inverted, Name:  - 56 pfk, - MG215 MG217 MG213 pyk, - MG216 hmw2, - MG218 MG214 MG214

Repeat ID: 24

DNA Molecule Name:
1

Repeat Name:


Repeat Type:
direct

Copy Number:
2.00

Comment:
length:101, Evalue:1.47e-50

Consensus:
AATCAACAGCAATTTAATCAACCAGGATTTGATCCTAACCAACAATATTA
TCAAGATCCCAATCAACAACAATTTAATCAAGCTGGTTTTGATCAAAACC
A

Repeat Unit Coordinates:
StartStop
258166258266
258286258386


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy