Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Mycoplasma genitalium Search Results

Record: 1 of 1  
MiniMap IGR285 IGR287 IGR288 MG384.1 MG385 era, - MG387 obg, - MG384 MG386 udk, - MG382 MG384.1 MG385 era, - MG387 obg, - MG384 MG386 udk, - MG382 Type: direct, Name:  - 28 Type: tandem, Name:  - 18 Type: tandem, Name:  - 19 Type: direct, Name:  - 28 MG384.1 MG385 era, - MG387 obg, - MG384 MG386 MG388 outB, - MG383 outB, - MG383 MG388 udk, - MG382

Repeat ID: 19

DNA Molecule Name:
1

Repeat Name:


Repeat Type:
tandem

Copy Number:
3.10

Comment:


Consensus:
AATCATAATTAGGTTCATCAA

Repeat Unit Coordinates:
StartStop
485718485738
485739485759
485760485780
485781485782


Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy