Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae

 IGS Flanking Sequence Viewer
This view is based on a particular Intergenic Space which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the Intergenic Space the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


IGS ID:IGR44
Strand:Forward
IGS Start: 72750
IGS Stop: 72933

72750  GTGGAAAAATCATCTTGGAGAATATCCTAAAGCTATTTACACTTGGGCTA  72799
72800  AATCTCCTTCAGAATAAGGCCTTCTTTCAAGGCCATTGTTGTATCCGAAA  72849
72850  CAAGGTTGAGTAGAGTACTTGCTTTCCTAGCAAAACTTTCTGAACTTAAA  72899
72900  TCAAGGAGGTTAAATACTAAAAAGGTATGTTGTT                  72933

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy