Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR93 IGR90 IGR89 IGR91 IGR92 hpt,hprT, - UU104 potC, - UU109 sys,serS, - UU106 potA, - UU107 UU103 potD, - UU110 ftsH, - UU105 hpt,hprT, - UU104 potC, - UU109 sys,serS, - UU106 potA, - UU107 UU103 potD, - UU110 ftsH, - UU105 Type: tandem, Name:  - 75 Type: tandem, Name:  - 80 Type: tandem, Name:  - 74 Type: tandem, Name:  - 78 Type: tandem, Name:  - 72 Type: tandem, Name:  - 79 Type: tandem, Name:  - 77 Type: tandem, Name:  - 73 Type: tandem, Name:  - 76 hpt,hprT, - UU104 potC, - UU109 sys,serS, - UU106 potA, - UU107 UU103 potD, - UU110 ftsH, - UU105 potB, - UU108 potB, - UU108

IGS ID: IGR92

DNA Molecule Name:
1  

IGS Start:
136389

IGS Stop:
136790

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAAATAAAATAAGAAGTTAACTTTAGTCATAAAGCTAGCTTCTTATTTTT
AATAAATACTGCTTGAAATTTTATACCTTTATTGATTGATATATCATTAA
TTACTATATGAAATATTTATTGGTTTTTAAATCAAAATTATTATTTTAAT
TTAAATAATTAAAAAATAAATTAAACTCTAAAAAAAGAGTTTTTTCTTTG
CTTTTACTATTAAAATTTAAGCTATTTTTCATATAAAAAAAACTTAAAAA
CAAAGCAAATTTTTACTTTAAAATCAAATTTAAAAAAAATAGTTGTTTTT
AATAATTTTATTAGTGTTTTTTATGTTATATTTTATTTGTTTTCAATTTT
GAAATATCATGAGTTTACTCATGTTTTATTTTTTTATTTATGGAGGATAT
AT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy