Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR5 IGR3 IGR8 IGR4 IGR6 IGR7 IGR9 IGR10 rbsC-2, - UU013 UU012 rbsC-1, - UU014 rpL7/L12, - UU011 rpiB, - UU006 UU008 rpL10, - UU010 UU007 hemK, - UU005 mgtE, - UU009 rbsC-2, - UU013 UU012 rbsC-1, - UU014 rpL7/L12, - UU011 rpiB, - UU006 UU008 rpL10, - UU010 UU007 hemK, - UU005 mgtE, - UU009 Type: tandem, Name:  - 6 Type: tandem, Name:  - 7 Type: tandem, Name:  - 429 rbsC-2, - UU013 UU012 rbsC-1, - UU014 rpiB, - UU006 UU008 rpL10, - UU010 UU007 hemK, - UU005 mgtE, - UU009 rpL7/L12, - UU011

IGS ID: IGR9

DNA Molecule Name:
1  

IGS Start:
8845

IGS Stop:
9068

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TTTTCTCTTTTTTATAAATTGTTATTAATTAAAAACCGGCATCTTTTATA
AAGGATACCGGTTTTTAATTCTATTTGTTTTTGTTCTAATCAAATTTAAT
TAGATATTTTATTAAGTTAAATTATAAAGTTATTATAGTTATAAATGATG
ATAAAAAAACATTAAGCGTTATACTAATTCATTTTTTATCTTGAATAGAC
ACATACTTAATGTTTTATTTTTAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy