Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR90 IGR88 IGR89 IGR91 IGR87 IGR92 UU101 hpt,hprT, - UU104 sys,serS, - UU106 potA, - UU107 UU103 ftsH, - UU105 uvrA, - UU102 UU101 hpt,hprT, - UU104 sys,serS, - UU106 potA, - UU107 UU103 ftsH, - UU105 uvrA, - UU102 Type: tandem, Name:  - 73 Type: tandem, Name:  - 70 Type: tandem, Name:  - 398 Type: tandem, Name:  - 71 Type: tandem, Name:  - 72 Type: tandem, Name:  - 74 UU101 hpt,hprT, - UU104 sys,serS, - UU106 potA, - UU107 UU103 ftsH, - UU105 uvrA, - UU102

IGS ID: IGR89

DNA Molecule Name:
1  

IGS Start:
132205

IGS Stop:
132230

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAATAATTACTTAATGGTATAATAGT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy