Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR3 IGR514 IGR510 IGR511 IGR513 IGR512 IGR4 IGR2 IGR1 IGR515 rpL34,rpmH, - UU604 rnpA, - UU603 ksgA, - UU601 UU602 UU598 gluS,gltX,syE, - UU599 rpL31, - UU002 rpiB, - UU006 hemK, - UU004 prfA, - UU003 dnaA, - UU001 rpL34,rpmH, - UU604 rnpA, - UU603 ksgA, - UU601 UU602 UU598 gluS,gltX,syE, - UU599 rpL31, - UU002 rpiB, - UU006 hemK, - UU004 prfA, - UU003 dnaA, - UU001 Type: tandem, Name:  - 4 Type: tandem, Name:  - 373 Type: tandem, Name:  - 376 Type: tandem, Name:  - 3 Type: tandem, Name:  - 371 Type: tandem, Name:  - 377 Type: tandem, Name:  - 390 Type: tandem, Name:  - 1 Type: tandem, Name:  - 375 Type: tandem, Name:  - 372 Type: tandem, Name:  - 6 Type: tandem, Name:  - 2 Type: tandem, Name:  - 374 Type: tandem, Name:  - 5 rnpA, - UU603 ksgA, - UU601 UU602 UU598 gluS,gltX,syE, - UU599 UU600 UU600 rpL34,rpmH, - UU604 rpL31, - UU002 rpiB, - UU006 hemK, - UU004 prfA, - UU003 dnaA, - UU001 hemK, - UU005 hemK, - UU005

IGS ID: IGR515

DNA Molecule Name:
1  

IGS Start:
751550

IGS Stop:
751719

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAATCCACCGCCCTCTTACTTTTTTGAAAACATAATATGGATTATTATAA
CATTTTAGTTATTTTTTATTTAATATATTTTTTTAAAAAAGTCAATGATA
TCTTTTTAAAAATAAACATATATAATATGATAATAGGACAAAGATTATTT
ATAAAAAATAGAGGTTACTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy