Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR410 IGR412 IGR409 IGR411 apt, - UU488 UU487 UU489 UU492 era, - UU491 priM,dnaG, - UU494 apt, - UU488 UU487 UU489 UU492 era, - UU491 priM,dnaG, - UU494 Type: tandem, Name:  - 295 Type: tandem, Name:  - 292 Type: tandem, Name:  - 293 Type: tandem, Name:  - 294 Type: tandem, Name:  - 419 apt, - UU488 UU487 UU489 UU492 era, - UU491 priM,dnaG, - UU494 UU490 syg,glyS, - UU493 UU490 syg,glyS, - UU493

IGS ID: IGR411

DNA Molecule Name:
1  

IGS Start:
588113

IGS Stop:
588433

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGTAAAACCAACTAACCTTGAATCATATTTTTAGAAATACTATAAACTCA
TAAAaACATTCATATTAACTAATTAATAATTATATATTAATTGTCATGAT
ATCACTTATTAAATTCCTAATTATTTTTAAACTTGTACAAAAATTGTGTT
TTTAACCTTAATATTTTTTATTTGCACTAATTTATTATTAAAAGAACCTT
TATAAATTAATAACTAAAAACGTTTTAGATTATTTTAGAAAATAAATAAT
GGAGTAATATGTTAAGGTTATAATTATTTATAATTTAATTATATTAGAAA
AAACAATTTAATAAGGATGTT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy