Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR240 IGR244 IGR243 IGR242 IGR241 IGR245 bsaA, - UU291 UU290 UU288 pmsR, - UU289 hisS, - UU285 aspS, - UU286 UU292 bsaA, - UU291 UU290 UU288 pmsR, - UU289 hisS, - UU285 aspS, - UU286 UU292 Type: tandem, Name:  - 171 bsaA, - UU291 UU290 pmsR, - UU289 hisS, - UU285 aspS, - UU286 UU292 UU287 UU288 UU287

IGS ID: IGR245

DNA Molecule Name:
1  

IGS Start:
327161

IGS Stop:
327481

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATTTTAATGTAAAACATTGAAATTATACTCTAAATTTAACAATATTATAT
ACTAGTTAGTTTTTGTAATATTTATTATAAAGTATAAGATGGAATCTAAG
TATCTATTAAAACATTAGTTGCTTTTGATATTTAATAAAAAATATTAAAA
AAAGTTATGATATTATTTTTGCTAAAATATATTAGGTAATTATTAAAAAT
AAAAAGATGTTTAAAGATTTTTTGTAATTTATtTACTAGATCTTTGTCTA
TCTTATTTTTACTATATTATTGTTTTTATAAATGTCCATTTTAAAACAAA
TTACGTTAGGAAGTGTTCAAT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy