Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR175 IGR176 IGR181 IGR180 IGR177 IGR178 IGR179 IGR174 rpL21, - UU212 ptc1, - UU215 UU217 UU214 pkn, - UU216 UU220 amt, - UU218 amt, - UU219 fthS, - UU221 rpL21, - UU212 ptc1, - UU215 UU217 UU214 pkn, - UU216 UU220 amt, - UU218 amt, - UU219 fthS, - UU221 Type: tandem, Name:  - 138 Type: tandem, Name:  - 135 Type: tandem, Name:  - 136 Type: tandem, Name:  - 137 rpL21, - UU212 ptc1, - UU215 UU217 UU214 pkn, - UU216 UU220 amt, - UU218 amt, - UU219 fthS, - UU221 gmk, - UU213 gmk, - UU213

IGS ID: IGR178

DNA Molecule Name:
1  

IGS Start:
260512

IGS Stop:
260647

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATAATTCTAATTCTTTAGTTGCAAAAATACTTTTTATAATTCGCTTGTGC
TTGCTTTTTATTTTTTTAGTACTATAATAGTAATATGTACTTAAAAATTA
TATTTTGTTTTAAAGTATAAAAAAAATAAATAAGAG



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy