Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR175 IGR167 IGR172 IGR176 IGR173 IGR168 IGR170 IGR169 IGR166 IGR177 IGR174 IGR171 UU208 rpL27, - UU210 rpL21, - UU212 UU211 UU209 plsX, - UU206 UU207 rpL28, - UU209.1 ptc1, - UU215 UU214 pkn, - UU216 UU208 rpL27, - UU210 rpL21, - UU212 UU211 UU209 plsX, - UU206 UU207 rpL28, - UU209.1 ptc1, - UU215 UU214 pkn, - UU216 Type: tandem, Name:  - 135 Type: tandem, Name:  - 132 Type: tandem, Name:  - 133 Type: tandem, Name:  - 134 Type: tandem, Name:  - 427 UU208 UU211 UU209 plsX, - UU206 UU207 rnc, - UU205 rnc, - UU205 rpL27, - UU210 rpL21, - UU212 rpL28, - UU209.1 ptc1, - UU215 UU214 pkn, - UU216 gmk, - UU213 gmk, - UU213

IGS ID: IGR171

DNA Molecule Name:
1  

IGS Start:
254454

IGS Stop:
254875

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGAACGAAAATGTTAAAAATAAAAAAATGTACAAACCATTGCTTGTACAT
TTTTTTATTATTAACTGGTTATTTTATTTAAAGTCCACTTAATTAAAACT
CTAGTTAATAAACAAATTTATATGACTGACATTAAGTTTTAATAACCGTT
TTTAATTAATAAATTTTTTAATGTTAATCATACATTATAAATATAACAAA
TTCAAATCTTAATTATATACAAATCATCAATTTTTATTGAAAAATGACGT
TAGAAATAATTTATAAACACAAATATAAAATAAGAAGATTAAAATCTTAA
GAAGAATATATATGTATATATATTAATATTCATATTTAGATTTTTTAAAA
GATAATTGTTAAACATTAATCAAATTACTTAAAGTAATATGTTTAAAATA
AAAAAAGAGGAATAATTCCTCT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy