Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR755 IGR760 IGR758 IGR761 IGR753 IGR759 IGR757 IGR754 IGR756 rpsI, - TP1024 rplM, - TP1025 recX, - TP1023 TP1030 TP1029 sms,radA, - TP1022 pcrA,uvrD, - TP1028 udp, - TP1027 tprL, - TP1031 TP1026 rpsI, - TP1024 rplM, - TP1025 recX, - TP1023 TP1030 TP1029 sms,radA, - TP1022 pcrA,uvrD, - TP1028 udp, - TP1027 tprL, - TP1031 TP1026 Type: tandem, Name:  - 223 Type: tandem, Name:  - 224 Type: tandem, Name:  - 280 rpsI, - TP1024 rplM, - TP1025 recX, - TP1023 TP1030 TP1029 sms,radA, - TP1022 pcrA,uvrD, - TP1028 udp, - TP1027 tprL, - TP1031 TP1026

IGS ID: IGR757

DNA Molecule Name:
1  

IGS Start:
1120113

IGS Stop:
1120236

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAGGTCTATGAAAAAAGGGTAAAAGATGCCTCGCCAAAAAGAGAACTACC
TGTCACCGTCCCCCGTGGTCGGGATTCTTCGTGACTGGGGAGTGCTGTGC
ACCTTACGCTTAAAGGGGAAACAC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy