Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR755 IGR758 IGR753 IGR752 IGR757 IGR754 IGR756 rpsI, - TP1024 rplM, - TP1025 recX, - TP1023 sms,radA, - TP1022 pcrA,uvrD, - TP1028 udp, - TP1027 gatB, - TP1021 TP1026 rpsI, - TP1024 rplM, - TP1025 recX, - TP1023 sms,radA, - TP1022 pcrA,uvrD, - TP1028 udp, - TP1027 gatB, - TP1021 TP1026 rpsI, - TP1024 rplM, - TP1025 recX, - TP1023 sms,radA, - TP1022 pcrA,uvrD, - TP1028 udp, - TP1027 gatB, - TP1021 TP1026 gatA,gluA, - TP1020 gatA,gluA, - TP1020

IGS ID: IGR754

DNA Molecule Name:
1  

IGS Start:
1116953

IGS Stop:
1117082

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
CAACTCCTCTATCGGGCAGGAAAGCGCGCCAAGGTAACTCAAGCGAGTCT
GCAGAACAGCACCCACCTCATCCGTAAGTTTAAGCACATCCTCCTGGAGG
CTCTGGATAGCACAGAGACAAAAGCGCCTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy