Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR747 IGR745 IGR748 IGR743 IGR744 IGR742 IGR746 ndk, - TP1010 pth, - TP1011 sigA,rpoD, - TP1012 gpsA, - TP1009 tpn39b,bmp, - TP1016 alaS, - TP1017 TP1014 nrdA, - TP1008 groES, - TP1013 ndk, - TP1010 pth, - TP1011 sigA,rpoD, - TP1012 gpsA, - TP1009 tpn39b,bmp, - TP1016 alaS, - TP1017 TP1014 nrdA, - TP1008 groES, - TP1013 ndk, - TP1010 pth, - TP1011 sigA,rpoD, - TP1012 gpsA, - TP1009 tpn39b,bmp, - TP1016 alaS, - TP1017 TP1014 nrdA, - TP1008 nusB, - TP1015 nusB, - TP1015 groES, - TP1013

IGS ID: IGR746

DNA Molecule Name:
1  

IGS Start:
1103976

IGS Stop:
1104179

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATATCATGCCATTTACGATAAACCAGAGGAGATCTGTTCGGTGTCCCTAT
CACGCCACTGGACCCTCTGTGCATACCTCCCTTTCCCACGGCGCGCTACA
GTTCTCTTGATTCTTCAAAAGGAAATGTATAGAATGCGCCCCGCGCGGTG
CGTGTAGGCATACGGCGCAAACGTGAAGATATGACTCGTTATGAGGAGGA
ACGC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy