Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR747 IGR745 IGR741 IGR743 IGR740 IGR744 IGR742 IGR746 ndk, - TP1010 pth, - TP1011 thy1, - TP1007 sigA,rpoD, - TP1012 gpsA, - TP1009 gyrB, - TP1006 TP1014 nrdA, - TP1008 groES, - TP1013 ndk, - TP1010 pth, - TP1011 thy1, - TP1007 sigA,rpoD, - TP1012 gpsA, - TP1009 gyrB, - TP1006 TP1014 nrdA, - TP1008 groES, - TP1013 ndk, - TP1010 pth, - TP1011 thy1, - TP1007 sigA,rpoD, - TP1012 gpsA, - TP1009 gyrB, - TP1006 TP1014 nrdA, - TP1008 nusB, - TP1015 nusB, - TP1015 groES, - TP1013

IGS ID: IGR743

DNA Molecule Name:
1  

IGS Start:
1101726

IGS Stop:
1101824

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GATTCCTAACCCCTCCCCTGATCCTCACCTTTCTTCAGCAAGAGGAAACA
TGATCACCGTATCGAAAAAGAACACGCACCGCAGACCCTAAACTTTTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy