Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR741 IGR739 IGR738 IGR743 IGR740 IGR744 IGR742 ndk, - TP1010 recR, - TP1004 pth, - TP1011 thy1, - TP1007 gpsA, - TP1009 dnaX, - TP1005 gyrB, - TP1006 nrdA, - TP1008 ndk, - TP1010 recR, - TP1004 pth, - TP1011 thy1, - TP1007 gpsA, - TP1009 dnaX, - TP1005 gyrB, - TP1006 nrdA, - TP1008 Type: tandem, Name:  - 222 ndk, - TP1010 recR, - TP1004 pth, - TP1011 thy1, - TP1007 gpsA, - TP1009 dnaX, - TP1005 gyrB, - TP1006 nrdA, - TP1008

IGS ID: IGR741

DNA Molecule Name:
1  

IGS Start:
1097949

IGS Stop:
1097993

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAAGAAAGCCTACACAGTGGACAGTGTTATGCAAGCACGCTCCTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy