Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR737 IGR741 IGR739 IGR738 IGR743 IGR740 IGR742 ndk, - TP1010 recR, - TP1004 thy1, - TP1007 gpsA, - TP1009 dnaX, - TP1005 gyrB, - TP1006 nrdA, - TP1008 TP1003 ndk, - TP1010 recR, - TP1004 thy1, - TP1007 gpsA, - TP1009 dnaX, - TP1005 gyrB, - TP1006 nrdA, - TP1008 TP1003 Type: tandem, Name:  - 222 ndk, - TP1010 recR, - TP1004 thy1, - TP1007 gpsA, - TP1009 dnaX, - TP1005 gyrB, - TP1006 nrdA, - TP1008 TP1003

IGS ID: IGR740

DNA Molecule Name:
1  

IGS Start:
1096923

IGS Stop:
1097033

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AACTGACCGCTCTCCTTTTCATCAGCATACCTATGACCACATTCACCTTT
TTAAGACACAGAAAGGCAATACTCTTGCTGCTCACACAGACGAGCGCACT
ATAGACTTCTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy