Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR735 IGR737 IGR731 IGR732 IGR738 IGR734 IGR733 IGR736 recR, - TP1004 TP1002 TP1001 TP0998 dnaX, - TP1005 sppA, - TP0997 TP1000 TP1003 TP0999 recR, - TP1004 TP1002 TP1001 TP0998 dnaX, - TP1005 sppA, - TP0997 TP1000 TP1003 TP0999 recR, - TP1004 TP1002 TP1001 TP0998 dnaX, - TP1005 sppA, - TP0997 TP1000 TP1003 TP0999

IGS ID: IGR733

DNA Molecule Name:
1  

IGS Start:
1088444

IGS Stop:
1088623

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAGTTGTTGCACATCTGCGTGTAAGAAAACGACGAACGATTGTTCAACGG
ACTTTTTGAAACTGCGCAATTGGGGTATGTGTCCACGGGTAAAAAAGGTG
AGGCACGATGCACCGGAGGCTGCCGGAAGGGTAGTCAGTGACTGCGCGAT
GCGCGCCTTCTTCTCAGGAAGGGCGGCAGA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy