Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Ala-3 IGR731 IGR732 IGR728 IGR729 IGR734 IGR730 IGR733 TP1001 TP0998 TP0996 sppA, - TP0997 TP1000 TP0995 TP0999 TP1001 TP0998 TP0996 sppA, - TP0997 TP1000 TP0995 TP0999 TP1001 TP0998 TP0996 sppA, - TP0997 TP1000 TP0995 TP0999

IGS ID: IGR731

DNA Molecule Name:
1  

IGS Start:
1084440

IGS Stop:
1084475

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGTAACCTCCACCTCATGTGTGTTATGCCTCGTCTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy