Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Ala-3 tRNA-Leu-5 IGR725 IGR731 IGR724 IGR728 IGR729 IGR726 IGR730 IGR727 rlpA, - TP0993 TP0998 TP0996 sppA, - TP0997 rubR, - TP0991 TP0992 TP0994 TP0995 TP0990 rlpA, - TP0993 TP0998 TP0996 sppA, - TP0997 rubR, - TP0991 TP0992 TP0994 TP0995 TP0990 Type: tandem, Name:  - 220 Type: tandem, Name:  - 221 rlpA, - TP0993 TP0998 TP0996 sppA, - TP0997 TP0992 TP0994 TP0995 TP0990 rubR, - TP0991

IGS ID: IGR729

DNA Molecule Name:
1  

IGS Start:
1080785

IGS Stop:
1080872

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGACCCTTCTCGGTCAACGAACACCCGACACCGGCGCACAAGCTATCCCC
TCATGACAGGACACCAACCGATTCAGGAGAAACTATCA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy