Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR645 IGR644 IGR641 IGR642 IGR643 rpsO, - TP0887 dut, - TP0885 ribF, - TP0888 TP0884 truB, - TP0889 TP0882 pnp, - TP0886 infB, - TP0891 rpsO, - TP0887 dut, - TP0885 ribF, - TP0888 TP0884 truB, - TP0889 TP0882 pnp, - TP0886 infB, - TP0891 Type: tandem, Name:  - 195 Type: tandem, Name:  - 196 Type: tandem, Name:  - 197 rpsO, - TP0887 dut, - TP0885 ribF, - TP0888 TP0884 truB, - TP0889 pnp, - TP0886 infB, - TP0891 rbfA, - TP0890 TP0883 rbfA, - TP0890 TP0882 TP0883

IGS ID: IGR643

DNA Molecule Name:
1  

IGS Start:
965051

IGS Stop:
965200

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ACGTTTCCTAAGAACAGAATGTATCGCAGGCCGCACCAAGCCCTGGCACA
GCCACCTGCGAAGCTAGACAAAGAAAGCAGAACGGACAACCGTCCTATGC
ACAACCCCTCGGCGGCACGCACTGCGAAACTTCCCCATGCAAAGCCCCTA




Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy