Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR645 IGR644 IGR641 IGR642 IGR640 IGR643 rpsO, - TP0887 dut, - TP0885 TP0881 ribF, - TP0888 TP0884 truB, - TP0889 TP0882 pnp, - TP0886 rpsO, - TP0887 dut, - TP0885 TP0881 ribF, - TP0888 TP0884 truB, - TP0889 TP0882 pnp, - TP0886 Type: tandem, Name:  - 197 Type: tandem, Name:  - 194 Type: tandem, Name:  - 195 Type: tandem, Name:  - 196 rpsO, - TP0887 dut, - TP0885 TP0881 ribF, - TP0888 TP0884 truB, - TP0889 TP0882 pnp, - TP0886 rbfA, - TP0890 TP0880 TP0883 rbfA, - TP0890 TP0883 TP0880

IGS ID: IGR642

DNA Molecule Name:
1  

IGS Start:
962476

IGS Stop:
962507

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAAAAGCACTCTTCTCCACATCTAGGTAACTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy