Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR434 IGR439 IGR437 IGR438 IGR436 IGR435 IGR433 TP0608 nifU, - TP0615 rpiA, - TP0616 TP0611 TP0613 nifS, - TP0614 TP0612 asnS, - TP0609 tprH, - TP0610 TP0608 nifU, - TP0615 rpiA, - TP0616 TP0611 TP0613 nifS, - TP0614 TP0612 asnS, - TP0609 tprH, - TP0610 Type: tandem, Name:  - 141 Type: tandem, Name:  - 258 TP0608 nifU, - TP0615 rpiA, - TP0616 TP0611 TP0613 nifS, - TP0614 TP0612 asnS, - TP0609 tprH, - TP0610

IGS ID: IGR436

DNA Molecule Name:
1  

IGS Start:
664246

IGS Stop:
664328

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAGAAAAAGTAAGTTATCCTTTTGTGGAGGCGCGCTGCCCCCACGCCAGC
AGACCGCATATCCACCGCTTAGAGGAAGCGCGT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy