Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Arg-3 IGR429 IGR434 IGR431 IGR430 IGR432 IGR433 rrf, - TP0604 TP0603 tsf, - TP0605 rpsB, - TP0606 TP0608 TP0601 TP0600 asnS, - TP0609 tprH, - TP0610 rrf, - TP0604 TP0603 tsf, - TP0605 rpsB, - TP0606 TP0608 TP0601 TP0600 asnS, - TP0609 tprH, - TP0610 Type: tandem, Name:  - 258 Type: tandem, Name:  - 138 Type: tandem, Name:  - 139 Type: tandem, Name:  - 140 rrf, - TP0604 TP0603 tsf, - TP0605 rpsB, - TP0606 TP0608 TP0601 TP0600 TP0607 cdsA, - TP0602 cdsA, - TP0602 TP0607 asnS, - TP0609 tprH, - TP0610

IGS ID: IGR431

DNA Molecule Name:
1  

IGS Start:
657127

IGS Stop:
657219

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GTACCCCTCCTGACAGCATTTTCCGATCAGACTTCGATGCAAACATGCCT
ACCCAGACACACATCCCAAAAGAGACCGCGGAGGGCACACCTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy