Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR391 IGR390 IGR389 IGR392 IGR394 IGR393 ruvA, - TP0543 mglB, - TP0545 pfpB, - TP0542 TP0544 htrA, - TP0546 TP0548 clpC, - TP0549 ruvA, - TP0543 mglB, - TP0545 pfpB, - TP0542 TP0544 htrA, - TP0546 TP0548 clpC, - TP0549 Type: tandem, Name:  - 254 ruvA, - TP0543 mglB, - TP0545 pfpB, - TP0542 TP0544 htrA, - TP0546 lytB, - TP0547 lytB, - TP0547 TP0548 clpC, - TP0549

IGS ID: IGR392

DNA Molecule Name:
1  

IGS Start:
588609

IGS Stop:
588695

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATTTCCTCCTCATGTTCACCAGCGCATTCTGATTTGACACTTCTTTCCCC
TCACACCCTGATACCCGCGCGAGGAATATAGAAATTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy