Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR388 IGR391 IGR390 IGR389 IGR392 IGR393 ruvA, - TP0543 mglB, - TP0545 pfpB, - TP0542 TP0544 htrA, - TP0546 era, - TP0541 TP0548 ruvA, - TP0543 mglB, - TP0545 pfpB, - TP0542 TP0544 htrA, - TP0546 era, - TP0541 TP0548 ruvA, - TP0543 mglB, - TP0545 pfpB, - TP0542 TP0544 htrA, - TP0546 lytB, - TP0547 lytB, - TP0547 era, - TP0541 TP0548

IGS ID: IGR391

DNA Molecule Name:
1  

IGS Start:
587520

IGS Stop:
587546

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AGGACACTCCTCACGCGCAGTGTATCA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy