Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Asn-1 IGR388 IGR380 IGR382 IGR379 IGR387 IGR383 IGR384 IGR385 IGR381 IGR386 TP0535 atpF, - TP0531 TP0536 TP0532 TP0530 tpi, - TP0537 pgk, - TP0538 atpI, - TP0533 pfpB, - TP0542 atpA, - TP0529 TP0539 TP0540 era, - TP0541 TP0535 atpF, - TP0531 TP0536 TP0532 TP0530 tpi, - TP0537 pgk, - TP0538 atpI, - TP0533 pfpB, - TP0542 atpA, - TP0529 TP0539 TP0540 era, - TP0541 TP0536 TP0532 tpi, - TP0537 pgk, - TP0538 atpI, - TP0533 pfpB, - TP0542 atpA, - TP0529 TP0534 TP0534 TP0535 TP0530 atpF, - TP0531 TP0540 era, - TP0541 TP0539

IGS ID: IGR384

DNA Molecule Name:
1  

IGS Start:
578906

IGS Stop:
579057

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GCCTCATGCTACACCAAAGCGTGCGCAAAAACAAGGACTTCAACCTTTCA
CTCCCTGTCCCGAGAACAGAAAAACGACCATGTGAACGGCACAAAAAAAG
AAACCTGCTTACGCAATACCGCACACCACCCAGAATCCTTTACTACTCTC
TA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy