Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR228 IGR229 IGR230 IGR231 mutL, - TP0303 TP0297 tpN38, - TP0298 rbsC, - TP0301 xylB, - TP0295 TpN50, - TP0292 prs, - TP0294 rbsA, - TP0300 mutL, - TP0303 TP0297 tpN38, - TP0298 rbsC, - TP0301 xylB, - TP0295 TpN50, - TP0292 prs, - TP0294 rbsA, - TP0300 Type: tandem, Name:  - 73 Type: tandem, Name:  - 242 mutL, - TP0303 TP0297 tpN38, - TP0298 rbsC, - TP0301 xylB, - TP0295 TpN50, - TP0292 prs, - TP0294 rbsA, - TP0300 TP0293 TP0299 TP0296 TP0302 TP0293 TP0299 TP0296 TP0302

IGS ID: IGR231

DNA Molecule Name:
1  

IGS Start:
310996

IGS Stop:
311130

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAGTCTTTCTCCTTCTCTCTGGGTGGTGCAATGCGTTTGGGGGCAGGGGT
GAGGAGTAGTGCTCTGGTCTTTTCAGGCTGTGGGTGCCGGTAGGGTGCAC
CCTACGCGAGAGAGGGATTTTTGGGGGGAGGTGTT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy