Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR228 IGR229 IGR227 IGR226 IGR230 IGR231 TP0297 TP0290 tpN38, - TP0298 xylB, - TP0295 TpN50, - TP0292 prs, - TP0294 rbsA, - TP0300 TP0289 TP0297 TP0290 tpN38, - TP0298 xylB, - TP0295 TpN50, - TP0292 prs, - TP0294 rbsA, - TP0300 TP0289 Type: tandem, Name:  - 72 Type: tandem, Name:  - 242 TP0297 TP0290 tpN38, - TP0298 xylB, - TP0295 TpN50, - TP0292 prs, - TP0294 rbsA, - TP0300 TP0289 TP0293 TP0299 TP0296 TP0291 TP0293 TP0299 TP0296 TP0291

IGS ID: IGR229

DNA Molecule Name:
1  

IGS Start:
308236

IGS Stop:
308256

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAGGGTAGCGTCGCAACGGAC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy