Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR224 IGR228 IGR229 IGR225 IGR227 IGR226 TP0287 TP0290 spsF, - TP0288 TP0285 xylB, - TP0295 TpN50, - TP0292 prs, - TP0294 TP0289 TP0287 TP0290 spsF, - TP0288 TP0285 xylB, - TP0295 TpN50, - TP0292 prs, - TP0294 TP0289 Type: tandem, Name:  - 290 Type: tandem, Name:  - 72 Type: tandem, Name:  - 240 Type: tandem, Name:  - 241 TP0290 spsF, - TP0288 TP0285 xylB, - TP0295 TpN50, - TP0292 prs, - TP0294 TP0289 TP0293 TP0286 TP0284 TP0291 TP0293 TP0284 TP0291 TP0287 TP0286

IGS ID: IGR226

DNA Molecule Name:
1  

IGS Start:
303755

IGS Stop:
303811

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGAAGTTGCCGTGTTGTTTTTTGGGTGTGCACTTGTTCAAGTTCAGAGGT
GATGTTG



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy