Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap rRNA-16SrRNA_1 IGR170 IGR168 IGR171 IGR169 IGR173 IGR174 IGR167 IGR172 IGR175 TP0224 spoIIAA, - TP0220 TP0222 TpLRR, - TP0225 TP0221 TP0217 aat, - TP0223 rsbU, - TP0218 rsbU, - TP0219 TP0224 spoIIAA, - TP0220 TP0222 TpLRR, - TP0225 TP0221 TP0217 aat, - TP0223 rsbU, - TP0218 rsbU, - TP0219 Type: tandem, Name:  - 63 Type: tandem, Name:  - 60 Type: tandem, Name:  - 61 Type: tandem, Name:  - 62 Type: tandem, Name:  - 287 TP0222 TpLRR, - TP0225 TP0221 TP0217 aat, - TP0223 rsbU, - TP0218 rsbU, - TP0219 TP0224 spoIIAA, - TP0220

IGS ID: IGR169

DNA Molecule Name:
1  

IGS Start:
225819

IGS Stop:
225849

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAGGAAATGAGGAAAAGTTCGGGAGCGCCGT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy