Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR107 IGR102 IGR106 IGR101 IGR103 IGR104 IGR105 TP0130 TP0126 TP0134 TP0133 tprD, - TP0131 TP0129 TP0127 exoA, - TP0125 TP0124 TP0130 TP0126 TP0134 TP0133 tprD, - TP0131 TP0129 TP0127 exoA, - TP0125 TP0124 Type: tandem, Name:  - 42 Type: tandem, Name:  - 39 Type: tandem, Name:  - 303 Type: tandem, Name:  - 40 Type: tandem, Name:  - 41 Type: tandem, Name:  - 302 Type: tandem, Name:  - 307 TP0130 TP0126 TP0134 TP0133 tprD, - TP0131 TP0132 TP0135 TP0132 TP0135 TP0127 exoA, - TP0125 TP0124 TP0128 TP0129 TP0128

IGS ID: IGR106

DNA Molecule Name:
1  

IGS Start:
151030

IGS Stop:
151103

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ACCGGGAAGTTGATGTCGGCTCCGGCTCGGGCTGTGGCATAGCCGCTAAC
GCACGGGGAGTGCACGCGTTTTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy