Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1674 IGR1681 IGR1683 IGR1678 IGR1676 IGR1679 IGR1677 IGR1682 IGR1680 IGR1675 NG2033 NG2040 potA, - NG2039 ptsH, - NG2037 ptsL,manX, - NG2036 hpt, - NG2035 petC, - NG2031 NG2034 petB,qcrB, - NG2030 ptsI, - NG2038 NG2032 NG2033 NG2040 potA, - NG2039 ptsH, - NG2037 ptsL,manX, - NG2036 hpt, - NG2035 petC, - NG2031 NG2034 petB,qcrB, - NG2030 ptsI, - NG2038 NG2032 NG2033 NG2040 potA, - NG2039 ptsH, - NG2037 ptsL,manX, - NG2036 hpt, - NG2035 petC, - NG2031 NG2034 petB,qcrB, - NG2030 ptsI, - NG2038 NG2032

IGS ID: IGR1678

DNA Molecule Name:
1  

IGS Start:
2005505

IGS Stop:
2005575

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGAGCAGGACGGCTCGGACGGCATCCGATACTTTGGTTTATAATTTTCCT
TTTACCGACCGATTCCGACAT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy