Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1674 IGR1668 IGR1673 IGR1676 IGR1677 IGR1672 IGR1671 IGR1670 IGR1675 IGR1667 IGR1669 NG2026 NG2033 metR, - NG2027 NG2023 rpsI, - NG2025 rplM, - NG2024 petA, - NG2029 NG2028 petC, - NG2031 petB,qcrB, - NG2030 NG2032 NG2026 NG2033 metR, - NG2027 NG2023 rpsI, - NG2025 rplM, - NG2024 petA, - NG2029 NG2028 petC, - NG2031 petB,qcrB, - NG2030 NG2032 NG2026 NG2033 metR, - NG2027 rpsI, - NG2025 rplM, - NG2024 petA, - NG2029 NG2028 petC, - NG2031 petB,qcrB, - NG2030 NG2032 NG2023

IGS ID: IGR1673

DNA Molecule Name:
1  

IGS Start:
1999596

IGS Stop:
1999616

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAAGAATAAGGAACGATAATT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy